Filters
Question type

Study Flashcards

You analyze some DNA using an automated sequence reaction.The first peak you observe is labeled with a red fluorescent label.From this you can conclude that the most ____ base in the DNA is a _____ containing the red fluorescent label.


A) 5',dideoxynucleotide
B) 3',deoxynucleotide
C) 5',deoxynucleotide
D) 3',dideoxynucleotide

E) B) and C)
F) A) and D)

Correct Answer

verifed

verified

You have the following DNA template and want to use PCR to amplify the double-stranded region that is underlined.What primer should you use? 5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3' 3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'


A) 5' - AGGGC- 3' and 5' -GATTG- 3'
B) 5' -CAATC- 3' and 5' -GCCCT- 3'
C) 3' -CAATC- 5' and 3' -GCCCT- 5'
D) 3' - AGGGC- 5' and 3' -GATTG- 5'
E) 5' -GTTAG -3' and 5' -ATCCC -3'

F) B) and D)
G) A) and D)

Correct Answer

verifed

verified

Primers are used in both PCR and in DNA sequencing.What is the purpose of the primers?


A) to provide a 3'- OH for DNA polymerase to build a new DNA strand
B) to terminate synthesis of the growing DNA strand
C) to add nucleotides to a growing DNA strand
D) to separate the DNA template strands
E) to separate various-sized DNA products

F) A) and B)
G) A) and C)

Correct Answer

verifed

verified

A small amount of DNA is collected from a crime scene.However,the amount of DNA collected is insufficient to perform the necessary experiments to link a suspect to the crime.Which method could be utilized to increase the amount of DNA?


A) microarray analysis
B) gel electrophoresis
C) polymerase chain reaction (PCR)
D) fluorescent labeling of DNA
E) DNA sequencing

F) None of the above
G) A) and E)

Correct Answer

verifed

verified

Shown below are steps in making a transgenic plant. 1) Expose plant cells to Agrobacterium tumefaciens 2) Place plant cells on selective medium 3) Transform the recombinant plasmid into Agrobacterium tumefaciens 4) Insert gene of interest into Ti plasmid 5) Place plant cells on growth medium with plant hormones What is the correct order of these steps?


A) 5 - 1 - 4 - 3 - 2
B) 4 - 3 - 1 - 2 - 5
C) 4 - 1 - 3 - 5 - 2
D) 2 - 4 - 1 - 3 - 5
E) None of the choices shows the correct order

F) A) and B)
G) A) and C)

Correct Answer

verifed

verified

You insert a fragment of sheep DNA into a plasmid containing an AmpR gene.You transform bacteria with the recombinant plasmid,and plate the cells on growth media containing the antibiotic ampicillin.Each colony on the plate arose from _____ that ____ to ampicillin.


A) a single cell;is sensitive
B) many bacteria;are resistant
C) many bacteria;are sensitive
D) a single cell;is resistant

E) A) and B)
F) A) and D)

Correct Answer

verifed

verified

What is true of cDNA produced using horse liver tissue as a starting material?


A) it could be used to create a library of genes expressed in horse liver
B) it is produced from tRNA using reverse transcriptase
C) it contains just the introns of genes from horse liver cells
D) it could be used to study how bacterial cells splice introns
E) it is produced using chromosomal DNA and DNA polymerase

F) A) and D)
G) B) and C)

Correct Answer

verifed

verified

Gene cloning


A) is the process of making multiple copies of a gene
B) is the process of isolating a particular gene of interest
C) is the process of determining the nucleotide sequence of a gene of interest
D) is the process of taking a gene of interest in one organism and putting it into another organism
E) is the process of making an organism that is genetically identical to its parent and its siblings

F) C) and D)
G) A) and D)

Correct Answer

verifed

verified

Which of the following is an example of a clone on the organism level?


A) identical twins
B) fraternal twins
C) plants grown from seeds collected from the same plant
D) offspring produced using in vitro fertilization
E) chicks hatched from the clutch of eggs

F) B) and D)
G) A) and E)

Correct Answer

verifed

verified

What is the most likely consequence of using a plasmid that lacks an origin of replication for a gene cloning project?


A) No recombinant plasmids will be created because the plasmid is only capable of re-circularizing.
B) Bacteria containing the plasmid will not be able to grow in the presence of antibiotics.
C) The plasmid will not be cut with restriction enzymes.
D) Multiple copies of the gene of interest will not be produced because the plasmid will be lost during bacterial division.
E) The plasmid will not be useful in producing a protein because it will lack an RNA polymerase binding sitE.

F) B) and E)
G) A) and B)

Correct Answer

verifed

verified

_____ occurs when a cloned gene recombines with the normal gene on a chromosome to create a genetically modified organism (GMO) .


A) recombination
B) gene replacement
C) transformation
D) molecular pharming
E) gene knockout

F) A) and E)
G) B) and E)

Correct Answer

verifed

verified

What statement concerning types of DNA libraries is true?


A) a cDNA library is derived from chromosomal DNA
B) a genomic library is derived from mRNA
C) a genomic library is made using mitochondrial DNA
D) a genomic library is derived from mRNA and is made using reverse transcriptase
E) a cDNA library is derived from mRNA and is made using reverse transcriptase

F) A) and C)
G) B) and C)

Correct Answer

verifed

verified

You have the target DNA and primers shown below.You add the target DNA and primers,along with dATP,dTTP,dGTP,dCTP and Taq DNA polymerase to a test tube.After 30 cycles of PCR,which of the following is true about the DNA in your test tube? Target DNA: 5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3' 3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5' Primer 1: 5' - GATCAA - 3' Primer 2: 5' - CGGAAA - 3'


A) There will be around a billion DNA molecules and most will look just like the template
5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3'
3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'
B) There will be around a billion DNA molecules and most will be single stranded,either
5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3' OR
3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'
C) Only the template and primers will be present;since no DNA helicase was added the strands won't separate so no new DNA can be made
D) There will be around a billion DNA molecules and most will contain the region that is flanked by the primers
5' - GATCAATCAATGCCGAATTTCCG - 3'
3' - CTAGTTAGTTACGGCTTAAAGGC - 5'
E) There will be around a million DNA molecules of various sizes,depending on where chain termination occurred

F) B) and C)
G) B) and D)

Correct Answer

verifed

verified

A genomic DNA library is derived from mRNA.

A) True
B) False

Correct Answer

verifed

verified

What is an advantage of molecular pharming compared to expression of mammalian proteins in bacteria?


A) molecular pharming is less complex because it does not require the use of plasmid vectors
B) molecular pharming produces fewer waste products because the protein yield is smaller than when using bacteria
C) molecular pharming is less expensive than producing proteins in bacteria
D) molecular pharming is less complex because post-translational modifications do not occur in mammals
E) proteins are more likely to function properly when expressed in mammals than when expressed in bacteria

F) C) and D)
G) A) and E)

Correct Answer

verifed

verified

Showing 41 - 55 of 55

Related Exams

Show Answer