A) 5',dideoxynucleotide
B) 3',deoxynucleotide
C) 5',deoxynucleotide
D) 3',dideoxynucleotide
Correct Answer
verified
Multiple Choice
A) 5' - AGGGC- 3' and 5' -GATTG- 3'
B) 5' -CAATC- 3' and 5' -GCCCT- 3'
C) 3' -CAATC- 5' and 3' -GCCCT- 5'
D) 3' - AGGGC- 5' and 3' -GATTG- 5'
E) 5' -GTTAG -3' and 5' -ATCCC -3'
Correct Answer
verified
Multiple Choice
A) to provide a 3'- OH for DNA polymerase to build a new DNA strand
B) to terminate synthesis of the growing DNA strand
C) to add nucleotides to a growing DNA strand
D) to separate the DNA template strands
E) to separate various-sized DNA products
Correct Answer
verified
Multiple Choice
A) microarray analysis
B) gel electrophoresis
C) polymerase chain reaction (PCR)
D) fluorescent labeling of DNA
E) DNA sequencing
Correct Answer
verified
Multiple Choice
A) 5 - 1 - 4 - 3 - 2
B) 4 - 3 - 1 - 2 - 5
C) 4 - 1 - 3 - 5 - 2
D) 2 - 4 - 1 - 3 - 5
E) None of the choices shows the correct order
Correct Answer
verified
Multiple Choice
A) a single cell;is sensitive
B) many bacteria;are resistant
C) many bacteria;are sensitive
D) a single cell;is resistant
Correct Answer
verified
Multiple Choice
A) it could be used to create a library of genes expressed in horse liver
B) it is produced from tRNA using reverse transcriptase
C) it contains just the introns of genes from horse liver cells
D) it could be used to study how bacterial cells splice introns
E) it is produced using chromosomal DNA and DNA polymerase
Correct Answer
verified
Multiple Choice
A) is the process of making multiple copies of a gene
B) is the process of isolating a particular gene of interest
C) is the process of determining the nucleotide sequence of a gene of interest
D) is the process of taking a gene of interest in one organism and putting it into another organism
E) is the process of making an organism that is genetically identical to its parent and its siblings
Correct Answer
verified
Multiple Choice
A) identical twins
B) fraternal twins
C) plants grown from seeds collected from the same plant
D) offspring produced using in vitro fertilization
E) chicks hatched from the clutch of eggs
Correct Answer
verified
Multiple Choice
A) No recombinant plasmids will be created because the plasmid is only capable of re-circularizing.
B) Bacteria containing the plasmid will not be able to grow in the presence of antibiotics.
C) The plasmid will not be cut with restriction enzymes.
D) Multiple copies of the gene of interest will not be produced because the plasmid will be lost during bacterial division.
E) The plasmid will not be useful in producing a protein because it will lack an RNA polymerase binding sitE.
Correct Answer
verified
Multiple Choice
A) recombination
B) gene replacement
C) transformation
D) molecular pharming
E) gene knockout
Correct Answer
verified
Multiple Choice
A) a cDNA library is derived from chromosomal DNA
B) a genomic library is derived from mRNA
C) a genomic library is made using mitochondrial DNA
D) a genomic library is derived from mRNA and is made using reverse transcriptase
E) a cDNA library is derived from mRNA and is made using reverse transcriptase
Correct Answer
verified
Multiple Choice
A) There will be around a billion DNA molecules and most will look just like the template
5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3'
3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'
B) There will be around a billion DNA molecules and most will be single stranded,either
5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3' OR
3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'
C) Only the template and primers will be present;since no DNA helicase was added the strands won't separate so no new DNA can be made
D) There will be around a billion DNA molecules and most will contain the region that is flanked by the primers
5' - GATCAATCAATGCCGAATTTCCG - 3'
3' - CTAGTTAGTTACGGCTTAAAGGC - 5'
E) There will be around a million DNA molecules of various sizes,depending on where chain termination occurred
Correct Answer
verified
True/False
Correct Answer
verified
Multiple Choice
A) molecular pharming is less complex because it does not require the use of plasmid vectors
B) molecular pharming produces fewer waste products because the protein yield is smaller than when using bacteria
C) molecular pharming is less expensive than producing proteins in bacteria
D) molecular pharming is less complex because post-translational modifications do not occur in mammals
E) proteins are more likely to function properly when expressed in mammals than when expressed in bacteria
Correct Answer
verified
Showing 41 - 55 of 55
Related Exams